Identification |
Name: |
Ribonucleoside-diphosphate reductase 1 subunit beta |
Synonyms: |
- Protein B2
- Protein R2
- Ribonucleotide reductase 1
|
Gene Name: |
nrdB |
Enzyme Class: |
|
Biological Properties |
General Function: |
Involved in oxidoreductase activity |
Specific Function: |
Provides the precursors necessary for DNA synthesis. Catalyzes the biosynthesis of deoxyribonucleotides from the corresponding ribonucleotides. R2 contains the tyrosyl radical required for catalysis |
Cellular Location: |
Not Available |
KEGG Pathways: |
|
KEGG Reactions: |
|
![Thumb](/molecules/PAMDB001728thumb.png) | + | Thioredoxin disulfide | + | ![Thumb](/molecules/PAMDB000142thumb.png) | ↔ | Thioredoxin | + | ![Thumb](/molecules/PAMDB000345thumb.png) |
| | |
dUDP | + | Thioredoxin disulfide | + | ![Thumb](/molecules/PAMDB000142thumb.png) | ↔ | Thioredoxin | + | ![Thumb](/molecules/PAMDB000123thumb.png) |
| | |
dGDP | + | Thioredoxin disulfide | + | ![Thumb](/molecules/PAMDB000142thumb.png) | ↔ | ![Thumb](/molecules/PAMDB000296thumb.png) | + | Thioredoxin |
| | |
![Thumb](/molecules/PAMDB000307thumb.png) | + | Thioredoxin disulfide | + | ![Thumb](/molecules/PAMDB000142thumb.png) | ↔ | Thioredoxin | + | ![Thumb](/molecules/PAMDB000415thumb.png) |
| | |
2'-Deoxyribonucleoside diphosphate | + | Thioredoxin disulfide | + | ![Thumb](/molecules/PAMDB000142thumb.png) | ↔ | Ribonucleoside diphosphate | + | ![Thumb](/molecules/PAMDB004174thumb.png) |
| |
|
SMPDB Reactions: |
|
![Thumb](/molecules/PAMDB000296thumb.png) | + | reduced thioredoxin | → | oxidized thioredoxin | + | ![Thumb](/molecules/PAMDB000142thumb.png) | + | dGDP | + | ![Thumb](/molecules/PAMDB000209thumb.png) |
| | |
Adenosine diphosphate | + | reduced thioredoxin | + | ![Thumb](/molecules/PAMDB000345thumb.png) | ↔ | ![Thumb](/molecules/PAMDB000142thumb.png) | + | oxidized thioredoxin | + | dADP | + | ![Thumb](/molecules/PAMDB001728thumb.png) |
| | |
Uridine 5'-diphosphate | + | reduced thioredoxin | + | ![Thumb](/molecules/PAMDB000123thumb.png) | ? | oxidized thioredoxin | + | ![Thumb](/molecules/PAMDB000142thumb.png) | + | dUDP | + | ![Thumb](/molecules/PAMDB000221thumb.png) |
| | |
![Thumb](/molecules/PAMDB000415thumb.png) | + | reduced thioredoxin | → | ![Thumb](/molecules/PAMDB000142thumb.png) | + | oxidized thioredoxin | + | ![Thumb](/molecules/PAMDB000307thumb.png) |
| |
|
PseudoCyc/BioCyc Reactions: |
|
Complex Reactions: |
|
Transports: |
Not Available |
Metabolites: |
|
GO Classification: |
Function |
---|
binding | catalytic activity | cation binding | ion binding | metal ion binding | oxidoreductase activity | oxidoreductase activity, acting on CH or CH2 groups | oxidoreductase activity, acting on CH or CH2 groups, disulfide as acceptor | ribonucleoside-diphosphate reductase activity | transition metal ion binding | Process |
---|
cellular nitrogen compound metabolic process | deoxyribonucleoside diphosphate metabolic process | metabolic process | nitrogen compound metabolic process | nucleobase, nucleoside and nucleotide metabolic process | nucleobase, nucleoside, nucleotide and nucleic acid metabolic process | nucleoside diphosphate metabolic process | nucleoside phosphate metabolic process | nucleotide metabolic process | oxidation reduction |
|
Gene Properties |
Locus tag: |
PA1155 |
Strand: |
- |
Entrez Gene ID: |
877692 |
Accession: |
NP_249846.1 |
GI: |
15596352 |
Sequence start: |
1249907 |
Sequence End: |
1251154 |
Sequence Length: |
1247 |
Gene Sequence: |
>PA1155
ATGCTGAGCTGGGACGAATTCGACAAAGAAGACCCGACCGAAGCCAAGGCCGCGCCCGCCGCCGCCCAGGCCGTTGCCCAGGGCCATGACAAGCTGGACGACGAAGCCGCCGGCTCGGTGGAAGAAGCGCGCGCCGTTTCCGCCGACGACTCCGACGCTGTCGCCCGCGCCAAGAAGGCCCTGAACGACCTCGACATCCAGGAAGGCTTGGACGACCTCGAAGGCTCCGCCGCGCGCGTGCAGGTCGGCGACAAGCAGATGATCAACGCCCGTGCCGACCTCAACCAGCTCGTTCCCTTCAAGTACGACTGGGCCTGGCAGAAGTATCTGGATGGTTGCGCCAACCACTGGATGCCGCAGGAAGTCAACATGAACGCCGACATCGCCCTGTGGAAGAGCAAGGACGGCCTCAGCGAAGACGAGCGGCGCATCGTCATGCGCAACCTCGGCTTCTTCTCCACCGCCGACTCGCTGGTCGCCAACAACCTGGTGCTGGCCGTGTACCGCCTGATCACCAACCCCGAGTGCCGCCAGTACATCCTGCGCCAGGCCTTCGAAGAGGCGATCCACACCCACGCCTACCAGTACTGCATCGAGTCGCTGGGCATGGACGAGGGCGAGATCTTCAACATGTACCACGAGATCCCCAGCGTGGCGAAGAAGGCCTCCTGGGGCCTGAAGTACACCCGCTCGATCTCCGACCCGATGTTCCAGACCGGCACCCCGGAAACCGACCGCCAGTTCCTGCGCAACCTGATCGCCTACTACTGCGTGCTGGAAGGCATCTTCTTCTACTGCGGCTTCACCCAGATCCTCTCCATGGGCCGCCGCAACAAGATGACCGGCACCGCCGAGCAGTTCCAGTACATCCTCCGCGACGAGTCGATGCACCTGAACTTCGGTATCGACGTGATCAACCAGATCAAGATCGAGAACCCGCACCTGTGGGACGCCCAGATGAAGGACGAGGCGACCCAGATGATCCTCCAGGGCACCCAGCTGGAGATCGAATACGCGCGCGACACCATGCCGCGCGGGGTGCTGGGCATGAACGCGGCGATGATGGAGGACTACCTGAAGTTCATCGCCAACCGGCGCCTGACCCAGATCGGCCTGAAGGAAGAGTATCCGGGGACCACCAACCCGTTCCCGTGGATGTCGGAGATCATGGACCTGAAGAAGGAGAAGAACTTCTTCGAGACGCGGGTTATCGAGTACCAGACGGGCGGAGCACTGAGCTGGGATTGA |
Protein Properties |
Protein Residues: |
415 |
Protein Molecular Weight: |
47.4 kDa |
Protein Theoretical pI: |
4.5 |
Hydropathicity (GRAVY score): |
-0.431 |
Charge at pH 7 (predicted): |
-21.44 |
Protein Sequence: |
>PA1155
MLSWDEFDKEDPTEAKAAPAAAQAVAQGHDKLDDEAAGSVEEARAVSADDSDAVARAKKALNDLDIQEGLDDLEGSAARVQVGDKQMINARADLNQLVPFKYDWAWQKYLDGCANHWMPQEVNMNADIALWKSKDGLSEDERRIVMRNLGFFSTADSLVANNLVLAVYRLITNPECRQYILRQAFEEAIHTHAYQYCIESLGMDEGEIFNMYHEIPSVAKKASWGLKYTRSISDPMFQTGTPETDRQFLRNLIAYYCVLEGIFFYCGFTQILSMGRRNKMTGTAEQFQYILRDESMHLNFGIDVINQIKIENPHLWDAQMKDEATQMILQGTQLEIEYARDTMPRGVLGMNAAMMEDYLKFIANRRLTQIGLKEEYPGTTNPFPWMSEIMDLKKEKNFFETRVIEYQTGGALSWD |
References |
External Links: |
|
General Reference: |
PaperBLAST - Find papers about PA1155 and its homologs
|