Identification |
Name: |
Diacylglycerol kinase |
Synonyms: |
- DAGK
- Diglyceride kinase
- DGK
|
Gene Name: |
dgkA |
Enzyme Class: |
|
Biological Properties |
General Function: |
Involved in diacylglycerol kinase activity |
Specific Function: |
Recycling of diacylglycerol produced during the turnover of membrane phospholipid |
Cellular Location: |
Cell inner membrane; Multi-pass membrane protein |
KEGG Pathways: |
|
KEGG Reactions: |
|
| + | 1,2-Diacyl-sn-glycerol | + | 1,2-Diacyl-sn-glycerol | ↔ | | + | |
| |
|
SMPDB Reactions: |
Not Available |
PseudoCyc/BioCyc Reactions: |
|
Complex Reactions: |
| | | | | | | | | | | | |
| + | 1,2-diacylglycerol | → | | + | 1,2-diacyl-sn-glycerol 3-phosphate |
| |
|
Transports: |
Not Available |
Metabolites: |
PAMDB ID | Name | View |
---|
PAMDB001512 | 1,2-Diacyl-sn-glycerol (didodecanoyl, n-C12:0) | MetaboCard | PAMDB001513 | 1,2-Diacyl-sn-glycerol (dihexadec-9-enoyl, n-C16:1) | MetaboCard | PAMDB001514 | 1,2-Diacyl-sn-glycerol (dihexadecanoyl, n-C16:0) | MetaboCard | PAMDB001515 | 1,2-Diacyl-sn-glycerol (dioctadec-11-enoyl, n-C18:1) | MetaboCard | PAMDB001517 | 1,2-Diacyl-sn-glycerol (ditetradec-7-enoyl, n-C14:1) | MetaboCard | PAMDB001518 | 1,2-Diacyl-sn-glycerol (ditetradecanoyl, n-C14:0) | MetaboCard | PAMDB001861 | 1,2-Dioctadecanoyl-sn-glycerol | MetaboCard | PAMDB000148 | Adenosine triphosphate | MetaboCard | PAMDB000345 | ADP | MetaboCard | PAMDB003631 | DG(10:0/10:0/0:0) | MetaboCard | PAMDB003632 | DG(10:0/12:0/0:0) | MetaboCard | PAMDB003633 | DG(10:0/14:0/0:0) | MetaboCard | PAMDB003634 | DG(10:0/15:0/0:0) | MetaboCard | PAMDB003635 | DG(10:0/16:0/0:0) | MetaboCard | PAMDB003636 | DG(10:0/16:1(9Z)/0:0) | MetaboCard | PAMDB003637 | DG(10:0/18:0/0:0) | MetaboCard | PAMDB003638 | DG(10:0/18:1(9Z)/0:0) | MetaboCard | PAMDB003639 | DG(10:0/19:1(9Z)/0:0) | MetaboCard | PAMDB003640 | DG(12:0/10:0/0:0) | MetaboCard | PAMDB003641 | DG(12:0/12:0/0:0) | MetaboCard | PAMDB003642 | DG(12:0/14:0/0:0) | MetaboCard | PAMDB003643 | DG(12:0/15:0/0:0) | MetaboCard | PAMDB003644 | DG(12:0/16:0/0:0) | MetaboCard | PAMDB003645 | DG(12:0/16:1(9Z)/0:0) | MetaboCard | PAMDB003646 | DG(12:0/18:0/0:0) | MetaboCard | PAMDB003647 | DG(12:0/18:1(9Z)/0:0) | MetaboCard | PAMDB003648 | DG(12:0/19:1(9Z)/0:0) | MetaboCard | PAMDB003649 | DG(14:0/10:0/0:0) | MetaboCard | PAMDB003650 | DG(14:0/12:0/0:0) | MetaboCard | PAMDB003651 | DG(14:0/14:0/0:0) | MetaboCard | PAMDB003652 | DG(14:0/15:0/0:0) | MetaboCard | PAMDB003653 | DG(14:0/16:0/0:0) | MetaboCard | PAMDB003654 | DG(14:0/16:1(9Z)/0:0) | MetaboCard | PAMDB003655 | DG(14:0/18:0/0:0) | MetaboCard | PAMDB003656 | DG(14:0/18:1(9Z)/0:0) | MetaboCard | PAMDB003657 | DG(14:0/19:1(9Z)/0:0) | MetaboCard | PAMDB003658 | DG(15:0/10:0/0:0) | MetaboCard | PAMDB003659 | DG(15:0/12:0/0:0) | MetaboCard | PAMDB003660 | DG(15:0/14:0/0:0) | MetaboCard | PAMDB003661 | DG(15:0/15:0/0:0) | MetaboCard | PAMDB003662 | DG(15:0/16:0/0:0) | MetaboCard | PAMDB003663 | DG(15:0/16:1(9Z)/0:0) | MetaboCard | PAMDB003664 | DG(15:0/18:0/0:0) | MetaboCard | PAMDB003665 | DG(15:0/18:1(9Z)/0:0) | MetaboCard | PAMDB003666 | DG(15:0/19:1(9Z)/0:0) | MetaboCard | PAMDB003667 | DG(16:0/10:0/0:0) | MetaboCard | PAMDB003668 | DG(16:0/12:0/0:0) | MetaboCard | PAMDB003669 | DG(16:0/14:0/0:0) | MetaboCard | PAMDB003670 | DG(16:0/15:0/0:0) | MetaboCard | PAMDB003671 | DG(16:0/16:0/0:0) | MetaboCard | PAMDB003672 | DG(16:0/16:1(9Z)/0:0) | MetaboCard | PAMDB003673 | DG(16:0/18:0/0:0) | MetaboCard | PAMDB003674 | DG(16:0/18:1(9Z)/0:0) | MetaboCard | PAMDB003675 | DG(16:0/19:1(9Z)/0:0) | MetaboCard | PAMDB003676 | DG(16:1(9Z)/10:0/0:0) | MetaboCard | PAMDB003677 | DG(16:1(9Z)/12:0/0:0) | MetaboCard | PAMDB003678 | DG(16:1(9Z)/14:0/0:0) | MetaboCard | PAMDB003679 | DG(16:1(9Z)/15:0/0:0) | MetaboCard | PAMDB003680 | DG(16:1(9Z)/16:0/0:0) | MetaboCard | PAMDB003681 | DG(16:1(9Z)/16:1(9Z)/0:0) | MetaboCard | PAMDB003682 | DG(16:1(9Z)/18:0/0:0) | MetaboCard | PAMDB003683 | DG(16:1(9Z)/18:1(9Z)/0:0) | MetaboCard | PAMDB003684 | DG(16:1(9Z)/19:1(9Z)/0:0) | MetaboCard | PAMDB003685 | DG(18:0/10:0/0:0) | MetaboCard | | DG(18:0/12:0/0:0) | MetaboCard | PAMDB003687 | DG(18:0/14:0/0:0) | MetaboCard | PAMDB003688 | DG(18:0/15:0/0:0) | MetaboCard | PAMDB003689 | DG(18:0/16:0/0:0) | MetaboCard | PAMDB003690 | DG(18:0/16:1(9Z)/0:0) | MetaboCard | PAMDB003691 | DG(18:0/18:0/0:0) | MetaboCard | PAMDB003692 | DG(18:0/18:1(9Z)/0:0) | MetaboCard | PAMDB003693 | DG(18:0/19:1(9Z)/0:0) | MetaboCard | PAMDB003694 | DG(18:1(9Z)/10:0/0:0) | MetaboCard | PAMDB003695 | DG(18:1(9Z)/12:0/0:0) | MetaboCard | PAMDB003696 | DG(18:1(9Z)/14:0/0:0) | MetaboCard | PAMDB003697 | DG(18:1(9Z)/15:0/0:0) | MetaboCard | PAMDB003698 | DG(18:1(9Z)/16:0/0:0) | MetaboCard | PAMDB003699 | DG(18:1(9Z)/16:1(9Z)/0:0) | MetaboCard | PAMDB003700 | DG(18:1(9Z)/18:0/0:0) | MetaboCard | PAMDB003701 | DG(18:1(9Z)/18:1(9Z)/0:0) | MetaboCard | PAMDB003702 | DG(18:1(9Z)/19:1(9Z)/0:0) | MetaboCard | PAMDB003703 | DG(19:1(9Z)/10:0/0:0) | MetaboCard | PAMDB003704 | DG(19:1(9Z)/12:0/0:0) | MetaboCard | PAMDB003705 | DG(19:1(9Z)/14:0/0:0) | MetaboCard | PAMDB003706 | DG(19:1(9Z)/15:0/0:0) | MetaboCard | PAMDB003707 | DG(19:1(9Z)/16:0/0:0) | MetaboCard | PAMDB003708 | DG(19:1(9Z)/16:1(9Z)/0:0) | MetaboCard | PAMDB003709 | DG(19:1(9Z)/18:0/0:0) | MetaboCard | PAMDB003710 | DG(19:1(9Z)/18:1(9Z)/0:0) | MetaboCard | PAMDB003711 | DG(19:1(9Z)/19:1(9Z)/0:0) | MetaboCard | PAMDB001633 | Hydrogen ion | MetaboCard | PAMDB000169 | PA(16:0/16:0) | MetaboCard |
|
GO Classification: |
Component |
---|
cell part | membrane | Function |
---|
catalytic activity | diacylglycerol kinase activity | kinase activity | transferase activity | transferase activity, transferring phosphorus-containing groups | Process |
---|
metabolic process | organophosphate metabolic process | phospholipid biosynthetic process | phospholipid metabolic process |
|
Gene Properties |
Locus tag: |
PA3603 |
Strand: |
- |
Entrez Gene ID: |
880149 |
Accession: |
NP_252293.1 |
GI: |
15598799 |
Sequence start: |
4037945 |
Sequence End: |
4038316 |
Sequence Length: |
371 |
Gene Sequence: |
>PA3603
GTGTCGCCTTCCCCCTTCAAAGGCCAGACCGGCCTCAAGCGTATCCTCAACGCCACCGGCTATTCCCTCGCAGGTTTCCTCGCCGCCTTCCGCGGTGAAGCCGCCTTCCGCCAACTGGTGCTGCTCAACGTGGTGCTGATCCCGGTGGCCTTCCTCCTCGACGTCAGTCGCGGCGAACGCGCGCTGATGATCGCGGTGTGCCTGCTGGCGCTGATCGTCGAGCTGCTCAACTCGGCGATCGAGGCCACCGTCGACCGCGTCTCGCTGGAACGCCACCCTCTGTCGAAGAATGCCAAGGACATGGGCAGCGCCGCGCAGTTCGTGGCCCTCACCGTGATCACCGTGACCTGGGCGACCATCCTGCTGGGCTGA |
Protein Properties |
Protein Residues: |
123 |
Protein Molecular Weight: |
13.1 kDa |
Protein Theoretical pI: |
10.03 |
Hydropathicity (GRAVY score): |
0.762 |
Charge at pH 7 (predicted): |
3.19 |
Protein Sequence: |
>PA3603
MSPSPFKGQTGLKRILNATGYSLAGFLAAFRGEAAFRQLVLLNVVLIPVAFLLDVSRGERALMIAVCLLALIVELLNSAIEATVDRVSLERHPLSKNAKDMGSAAQFVALTVITVTWATILLG |
References |
External Links: |
|
General Reference: |
PaperBLAST - Find papers about PA3603 and its homologs
|