Identification |
Name: |
Phosphate import ATP-binding protein pstB |
Synonyms: |
- ABC phosphate transporter
- Phosphate-transporting ATPase
|
Gene Name: |
pstB |
Enzyme Class: |
|
Biological Properties |
General Function: |
Involved in nucleotide binding |
Specific Function: |
Part of the ABC transporter complex pstSACB involved in phosphate import. Responsible for energy coupling to the transport system |
Cellular Location: |
Cell inner membrane; Peripheral membrane protein |
KEGG Pathways: |
|
KEGG Reactions: |
Not Available |
SMPDB Reactions: |
Not Available |
PseudoCyc/BioCyc Reactions: |
|
![Thumb](/molecules/PAMDB000148thumb.png) | + | ![Thumb](/molecules/PAMDB000142thumb.png) | + | phosphate(Out) | → | ![Thumb](/molecules/PAMDB000345thumb.png) | + | ![Thumb](/molecules/PAMDB001776thumb.png) | + | phosphate(In) |
| |
|
Complex Reactions: |
Not Available |
Transports: |
|
Metabolites: |
|
GO Classification: |
Component |
---|
cell part | membrane | Function |
---|
adenyl nucleotide binding | adenyl ribonucleotide binding | anion transmembrane transporter activity | ATP binding | ATPase activity | binding | catalytic activity | hydrolase activity | hydrolase activity, acting on acid anhydrides | hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides | inorganic anion transmembrane transporter activity | inorganic phosphate transmembrane transporter activity | ion transmembrane transporter activity | nucleoside binding | nucleoside-triphosphatase activity | nucleotide binding | phosphate transmembrane transporter activity | phosphate transmembrane-transporting ATPase activity | purine nucleoside binding | pyrophosphatase activity | substrate-specific transmembrane transporter activity | transmembrane transporter activity | transporter activity | Process |
---|
anion transport | establishment of localization | inorganic anion transport | ion transport | phosphate transport | transport |
|
Gene Properties |
Locus tag: |
PA5366 |
Strand: |
- |
Entrez Gene ID: |
881628 |
Accession: |
NP_254053.1 |
GI: |
15600559 |
Sequence start: |
6033211 |
Sequence End: |
6034044 |
Sequence Length: |
833 |
Gene Sequence: |
>PA5366
ATGCAAAACGAGACCGCCAGCCACGGCATCAACTTCGATGCGCTCGGCCGCGACCGCCAGAGCCTCGACCTGGCTTCCGAAAGTGTCGAACTGGAAGTGCCCGGGCTGAACCTGTTCTACGGCGCCAAGCAGGCCCTTTTCGACGTCCGGATGAACATTCCGAAGCAGCGCGTGACCGCCTTCATCGGCCCGTCCGGCTGCGGCAAGTCGACCTTGCTGCGCTGCTTCAACCGGATGAACGACCTGGTGGATGGCTGCCGCGTCGAAGGCGAGATTCGCCTCGATGGCCACAACATCTTCGCCAAGGGCGTCGACGTCGCCGAGCTGCGCCGTCGCGTCGGCATGGTGTTCCAGAAGCCCAACCCGTTCCCCAAGAGCATCTACGAGAACGTGGTCTACGGCCTGCGTATCCAGGGCATCAACAAGAAGCGCGTACTTGACGAGGCCGTCGAGTGGGCGCTGAAGGGGGCTGCGCTGTGGGAGGAGGTGAAGGATCGCCTGCACGAGTCCGCCCTCGGCCTGTCCGGCGGCCAGCAGCAGCGCCTGGTGATCGCCCGGACCATCGCGGTGGAACCGGAAGTGCTGCTGCTCGACGAGCCGTGCTCGGCGCTGGACCCGATCTCCACGCTGAAGATCGAAGAGCTGATCTACGAGTTGAAGTCGAAGTTCACCATCGTCATCGTTACCCACAACATGCAGCAGGCCGCGCGGGTTTCCGACTATACGGCGTTCATGTACATGGGCAAGCTGATCGAGTTCGGCGACACCGATACGCTGTTCACCAACCCGGCGAAGAAGCAGACCGAAGACTACATCACCGGCCGCTACGGCTAG |
Protein Properties |
Protein Residues: |
277 |
Protein Molecular Weight: |
31 kDa |
Protein Theoretical pI: |
6.16 |
Hydropathicity (GRAVY score): |
-0.211 |
Charge at pH 7 (predicted): |
-2.16 |
Protein Sequence: |
>PA5366
MQNETASHGINFDALGRDRQSLDLASESVELEVPGLNLFYGAKQALFDVRMNIPKQRVTAFIGPSGCGKSTLLRCFNRMNDLVDGCRVEGEIRLDGHNIFAKGVDVAELRRRVGMVFQKPNPFPKSIYENVVYGLRIQGINKKRVLDEAVEWALKGAALWEEVKDRLHESALGLSGGQQQRLVIARTIAVEPEVLLLDEPCSALDPISTLKIEELIYELKSKFTIVIVTHNMQQAARVSDYTAFMYMGKLIEFGDTDTLFTNPAKKQTEDYITGRYG |
References |
External Links: |
|
General Reference: |
PaperBLAST - Find papers about PA5366 and its homologs
|