Identification |
Name: |
Cytochrome o ubiquinol oxidase protein cyoD |
Synonyms: |
- Ubiquinol oxidase chain D
|
Gene Name: |
cyoD |
Enzyme Class: |
Not Available |
Biological Properties |
General Function: |
Involved in cytochrome o ubiquinol oxidase activity |
Specific Function: |
Cytochrome o terminal oxidase complex is the component of the aerobic respiratory chain of E.coli that predominates when cells are grown at high aeration |
Cellular Location: |
Cell inner membrane; Multi-pass membrane protein |
KEGG Pathways: |
- Oxidative phosphorylation PW000919
- succinate to cytochrome bo oxidase electron transfer PWY0-1329
- proline to cytochrome bo oxidase electron transfer PWY0-1544
- NADH to cytochrome bo oxidase electron transfer PWY0-1335
|
KEGG Reactions: |
Not Available |
SMPDB Reactions: |
|
PseudoCyc/BioCyc Reactions: |
| | | | |
| + | | + | Ubiquinols | → | | + | Ubiquinones | + | |
| |
|
Complex Reactions: |
|
Transports: |
Not Available |
Metabolites: |
|
GO Classification: |
Component |
---|
cell part | integral to membrane | intrinsic to membrane | membrane part | Function |
---|
catalytic activity | cytochrome o ubiquinol oxidase activity | heme-copper terminal oxidase activity | oxidoreductase activity | Process |
---|
electron transport coupled proton transport | energy coupled proton transport, against electrochemical gradient | establishment of localization | hydrogen transport | proton transport | transport |
|
Gene Properties |
Locus tag: |
PA1320 |
Strand: |
+ |
Entrez Gene ID: |
881604 |
Accession: |
NP_250011.1 |
GI: |
15596517 |
Sequence start: |
1431691 |
Sequence End: |
1432026 |
Sequence Length: |
335 |
Gene Sequence: |
>PA1320
ATGAGCAGCGCTGCACACGACAACCACGGCGCCGGCCACGGCAGCCTGGGTTCCTACGCGATCGGCTTCGTGCTCTCGGTGATCCTCACCGCGATCCCGTTCTACATGGTCATGGACGGCGGCTTCTCGCGCCACGCGACCATCCTCACCATGGTCGTCCTCGGCCTGGTGCAGGTGGTGGTGCACCTGATCTGCTTCCTGCACATGAACATGTCGTCGGAAGGGCGCTGGAACGTGATGGCGTTCATCTTCACGGTGATCGTCATCCTGCTGGTGGTCGGTCTCTCGCTGTGGATCATCTTCAGCGCCGACATGCTGATGATGCCGATGCCCTGA |
Protein Properties |
Protein Residues: |
111 |
Protein Molecular Weight: |
12.1 kDa |
Protein Theoretical pI: |
6.79 |
Hydropathicity (GRAVY score): |
1.175 |
Charge at pH 7 (predicted): |
-0.61 |
Protein Sequence: |
>PA1320
MSSAAHDNHGAGHGSLGSYAIGFVLSVILTAIPFYMVMDGGFSRHATILTMVVLGLVQVVVHLICFLHMNMSSEGRWNVMAFIFTVIVILLVVGLSLWIIFSADMLMMPMP |
References |
External Links: |
|
General Reference: |
PaperBLAST - Find papers about PA1320 and its homologs
|