| Identification |
| Name: |
Peptide methionine sulfoxide reductase msrB |
| Synonyms: |
- Peptide-methionine (R)-S-oxide reductase
|
| Gene Name: |
msrB |
| Enzyme Class: |
|
| Biological Properties |
| General Function: |
Involved in peptide-methionine-(S)-S-oxide reductase activity |
| Specific Function: |
Peptide-L-methionine + thioredoxin disulfide + H(2)O = peptide-L-methionine (R)-S-oxide + thioredoxin |
| Cellular Location: |
Not Available |
| KEGG Pathways: |
Not Available |
| KEGG Reactions: |
|
Peptide-L-methionine | + | Thioredoxin disulfide | + |  | ↔ | Peptide-L-methionine (R)-S-oxide | + |  |
| |
|
| SMPDB Reactions: |
Not Available |
| PseudoCyc/BioCyc Reactions: |
|
| Complex Reactions: |
|
| Transports: |
Not Available |
| Metabolites: |
|
| GO Classification: |
| Function |
|---|
| catalytic activity | | oxidoreductase activity | | oxidoreductase activity, acting on a sulfur group of donors | | oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor | | peptide-methionine-(S)-S-oxide reductase activity | | Process |
|---|
| metabolic process | | oxidation reduction |
|
| Gene Properties |
| Locus tag: |
PA2827 |
| Strand: |
- |
| Entrez Gene ID: |
878842 |
| Accession: |
NP_251517.1 |
| GI: |
15598023 |
| Sequence start: |
3180554 |
| Sequence End: |
3180952 |
| Sequence Length: |
398 |
| Gene Sequence: |
>PA2827
ATGAGCAAGATCGACAAACCCCTGGACTCCTGGCGCGAGGAGTTGACCGAAGAGCAGTTCCACATCTGTCGCCTGGGCGGTACCGAACGCGCCTTCAGTGGCGAATACCACGCCACCAAGACCCCCGGGATCTATCATTGCACCTGCTGCGGCACGGCGTTGTTCGACTCCGACGCCAAGTACGACTCCGGCAGCGGTTGGCCGAGCTATTTCCAGCCGGTGGACGCCGAGGCGGTCCGCGAACTGGACGACTTCAGCCACGGCATGCATCGCATCGAAGTCCGCTGCGGTCGCTGCGATGCCCACCTGGGGCACGTCTTCCCGGATGGCCCCCGGCCCACCGGGTTGCGTTACTGCATCAACTCGGCCTCGCTGAAGCTGGTGCCGCGGGAGAGCTAG |
| Protein Properties |
| Protein Residues: |
132 |
| Protein Molecular Weight: |
14.8 kDa |
| Protein Theoretical pI: |
6.14 |
| Hydropathicity (GRAVY score): |
-0.582 |
| Charge at pH 7 (predicted): |
-3.54 |
| Protein Sequence: |
>PA2827
MSKIDKPLDSWREELTEEQFHICRLGGTERAFSGEYHATKTPGIYHCTCCGTALFDSDAKYDSGSGWPSYFQPVDAEAVRELDDFSHGMHRIEVRCGRCDAHLGHVFPDGPRPTGLRYCINSASLKLVPRES |
| References |
| External Links: |
|
| General Reference: |
PaperBLAST - Find papers about PA2827 and its homologs
|