Identification |
Name: |
NADPH-dependent 7-cyano-7-deazaguanine reductase |
Synonyms: |
- 7-cyano-7-carbaguanine reductase
- NADPH-dependent nitrile oxidoreductase
- PreQ(0) reductase
|
Gene Name: |
queF |
Enzyme Class: |
|
Biological Properties |
General Function: |
Involved in oxidoreductase activity, acting on other nitrogenous compounds as donors, with NAD or NADP as acceptor |
Specific Function: |
Catalyzes the NADPH-dependent reduction of 7-cyano-7- deazaguanine (preQ0) to 7-aminomethyl-7-deazaguanine (preQ1) |
Cellular Location: |
Cytoplasm (Probable) |
KEGG Pathways: |
|
KEGG Reactions: |
|
SMPDB Reactions: |
| | |
 | + | 3  | + | 2 NADPH | + | 2  | → | Queuine | + | 2  | + |  |
| |
|
PseudoCyc/BioCyc Reactions: |
| | | | | | | | |
 | + | 3  | + | 2 NADPH | + | 2  | → | Queuine | + | 2  | + |  |
| | | |
|
Complex Reactions: |
|
Transports: |
Not Available |
Metabolites: |
|
GO Classification: |
Component |
---|
cell part | cytoplasm | intracellular part | Function |
---|
catalytic activity | oxidoreductase activity | oxidoreductase activity, acting on other nitrogenous compounds as donors | oxidoreductase activity, acting on other nitrogenous compounds as donors, with NAD or NADP as acceptor | Process |
---|
cellular macromolecule metabolic process | macromolecule metabolic process | metabolic process | ncRNA metabolic process | oxidation reduction | queuosine biosynthetic process | RNA metabolic process | tRNA metabolic process | tRNA modification | tRNA processing |
|
Gene Properties |
Locus tag: |
PA2806 |
Strand: |
- |
Entrez Gene ID: |
880562 |
Accession: |
NP_251496.1 |
GI: |
15598002 |
Sequence start: |
3160651 |
Sequence End: |
3161481 |
Sequence Length: |
830 |
Gene Sequence: |
>PA2806
ATGCAGCATCCCGCCGAACATTCGCCGCTGGGCAAGACCAGCGAATACGTCTCCAGCTACACGCCGTCGCTGCTGTTTCCCATTTCACGCACGGCGAAATGGGCCGAGCTTGGCCTGAGCGCCGAGACCCTGCCTTATCGCGGCGTGGATATCTGGAACTGCTACGAGCTGTCCTGGCTGACCCCGGCCGGCAAGCCGGTGGTGGCGATCGGCGAGTTCTCGATCCCGGCGGACTCGCCGAACATCATCGAGTCGAAGTCGTTCAAGCTTTACCTCAATTCCCTCAACCAGTCCGCCTTCGATAGTCGCGAGGCGCTTCGCGCGGTATTGCAGAAAGACCTCTCGGCCGCTGTCGGGGCGCCCGTGGGCGTGCGCCTGCGCAGCCTCGACGAAGTTGCCGAGGAGGGCATCGGGCGTCTGCCGGGGCGCTGCATCGACGAGCTGGACATCGCCGTCGACGGCTACGAGCAGCCGCGCCCGGAACTGCTGCGCTGCGACGCCGGGCGGATCGTCGAGGAGCAGCTCTACAGCCACCTGCTCAAGTCCAACTGCCCGGTCACCGGCCAGCCCGACTGGGGCACCCTGGTGGTCGACTACCGGGGCCCGGCGCTGGACCCGGCCAGCCTGCTGGCCTACCTGGTTTCCTTCCGCCAGCACCAGGACTTCCACGAACAGTGCGTCGAACGCATCTTCCTCGACCTGCAGCGCCTGTTGCAGCCGCAGGCGCTCAGCGTCTACGCGCGCTACGTACGCCGTGGCGGCCTGGATATCAATCCCTACCGCAGCCTGGCGGAGGTCGCACCGGACAACCGACGCCTGGTGCGCCAGTAA |
Protein Properties |
Protein Residues: |
276 |
Protein Molecular Weight: |
30.8 kDa |
Protein Theoretical pI: |
5.41 |
Hydropathicity (GRAVY score): |
-0.239 |
Charge at pH 7 (predicted): |
-4.95 |
Protein Sequence: |
>PA2806
MQHPAEHSPLGKTSEYVSSYTPSLLFPISRTAKWAELGLSAETLPYRGVDIWNCYELSWLTPAGKPVVAIGEFSIPADSPNIIESKSFKLYLNSLNQSAFDSREALRAVLQKDLSAAVGAPVGVRLRSLDEVAEEGIGRLPGRCIDELDIAVDGYEQPRPELLRCDAGRIVEEQLYSHLLKSNCPVTGQPDWGTLVVDYRGPALDPASLLAYLVSFRQHQDFHEQCVERIFLDLQRLLQPQALSVYARYVRRGGLDINPYRSLAEVAPDNRRLVRQ |
References |
External Links: |
|
General Reference: |
PaperBLAST - Find papers about PA2806 and its homologs
|