| Identification |
| Name: |
NADPH-dependent 7-cyano-7-deazaguanine reductase |
| Synonyms: |
- 7-cyano-7-carbaguanine reductase
- NADPH-dependent nitrile oxidoreductase
- PreQ(0) reductase
|
| Gene Name: |
queF |
| Enzyme Class: |
|
| Biological Properties |
| General Function: |
Involved in oxidoreductase activity, acting on other nitrogenous compounds as donors, with NAD or NADP as acceptor |
| Specific Function: |
Catalyzes the NADPH-dependent reduction of 7-cyano-7- deazaguanine (preQ0) to 7-aminomethyl-7-deazaguanine (preQ1) |
| Cellular Location: |
Cytoplasm (Probable) |
| KEGG Pathways: |
|
| KEGG Reactions: |
|
| SMPDB Reactions: |
| | |
 | + | 3  | + | 2 NADPH | + | 2  | → | Queuine | + | 2  | + |  |
| |
|
| PseudoCyc/BioCyc Reactions: |
| | | | | | | | |
 | + | 3  | + | 2 NADPH | + | 2  | → | Queuine | + | 2  | + |  |
| | | |
|
| Complex Reactions: |
|
| Transports: |
Not Available |
| Metabolites: |
|
| GO Classification: |
| Component |
|---|
| cell part | | cytoplasm | | intracellular part | | Function |
|---|
| catalytic activity | | oxidoreductase activity | | oxidoreductase activity, acting on other nitrogenous compounds as donors | | oxidoreductase activity, acting on other nitrogenous compounds as donors, with NAD or NADP as acceptor | | Process |
|---|
| cellular macromolecule metabolic process | | macromolecule metabolic process | | metabolic process | | ncRNA metabolic process | | oxidation reduction | | queuosine biosynthetic process | | RNA metabolic process | | tRNA metabolic process | | tRNA modification | | tRNA processing |
|
| Gene Properties |
| Locus tag: |
PA2806 |
| Strand: |
- |
| Entrez Gene ID: |
880562 |
| Accession: |
NP_251496.1 |
| GI: |
15598002 |
| Sequence start: |
3160651 |
| Sequence End: |
3161481 |
| Sequence Length: |
830 |
| Gene Sequence: |
>PA2806
ATGCAGCATCCCGCCGAACATTCGCCGCTGGGCAAGACCAGCGAATACGTCTCCAGCTACACGCCGTCGCTGCTGTTTCCCATTTCACGCACGGCGAAATGGGCCGAGCTTGGCCTGAGCGCCGAGACCCTGCCTTATCGCGGCGTGGATATCTGGAACTGCTACGAGCTGTCCTGGCTGACCCCGGCCGGCAAGCCGGTGGTGGCGATCGGCGAGTTCTCGATCCCGGCGGACTCGCCGAACATCATCGAGTCGAAGTCGTTCAAGCTTTACCTCAATTCCCTCAACCAGTCCGCCTTCGATAGTCGCGAGGCGCTTCGCGCGGTATTGCAGAAAGACCTCTCGGCCGCTGTCGGGGCGCCCGTGGGCGTGCGCCTGCGCAGCCTCGACGAAGTTGCCGAGGAGGGCATCGGGCGTCTGCCGGGGCGCTGCATCGACGAGCTGGACATCGCCGTCGACGGCTACGAGCAGCCGCGCCCGGAACTGCTGCGCTGCGACGCCGGGCGGATCGTCGAGGAGCAGCTCTACAGCCACCTGCTCAAGTCCAACTGCCCGGTCACCGGCCAGCCCGACTGGGGCACCCTGGTGGTCGACTACCGGGGCCCGGCGCTGGACCCGGCCAGCCTGCTGGCCTACCTGGTTTCCTTCCGCCAGCACCAGGACTTCCACGAACAGTGCGTCGAACGCATCTTCCTCGACCTGCAGCGCCTGTTGCAGCCGCAGGCGCTCAGCGTCTACGCGCGCTACGTACGCCGTGGCGGCCTGGATATCAATCCCTACCGCAGCCTGGCGGAGGTCGCACCGGACAACCGACGCCTGGTGCGCCAGTAA |
| Protein Properties |
| Protein Residues: |
276 |
| Protein Molecular Weight: |
30.8 kDa |
| Protein Theoretical pI: |
5.41 |
| Hydropathicity (GRAVY score): |
-0.239 |
| Charge at pH 7 (predicted): |
-4.95 |
| Protein Sequence: |
>PA2806
MQHPAEHSPLGKTSEYVSSYTPSLLFPISRTAKWAELGLSAETLPYRGVDIWNCYELSWLTPAGKPVVAIGEFSIPADSPNIIESKSFKLYLNSLNQSAFDSREALRAVLQKDLSAAVGAPVGVRLRSLDEVAEEGIGRLPGRCIDELDIAVDGYEQPRPELLRCDAGRIVEEQLYSHLLKSNCPVTGQPDWGTLVVDYRGPALDPASLLAYLVSFRQHQDFHEQCVERIFLDLQRLLQPQALSVYARYVRRGGLDINPYRSLAEVAPDNRRLVRQ |
| References |
| External Links: |
|
| General Reference: |
PaperBLAST - Find papers about PA2806 and its homologs
|