| Identification |
| Name: |
Holliday junction ATP-dependent DNA helicase ruvA |
| Synonyms: |
Not Available |
| Gene Name: |
ruvA |
| Enzyme Class: |
|
| Biological Properties |
| General Function: |
Replication, recombination and repair |
| Specific Function: |
The ruvA-ruvB complex in the presence of ATP renatures cruciform structure in supercoiled DNA with palindromic sequence, indicating that it may promote strand exchange reactions in homologous recombination. RuvAB is an helicase that mediates the Holliday junction migration by localized denaturation and reannealing. RuvA stimulates, in the presence of DNA, the weak ATPase activity of ruvB. Binds both single- and double-stranded DNA (dsDNA). Binds preferentially to supercoiled rather than to relaxed dsDNA |
| Cellular Location: |
Cytoplasmic |
| KEGG Pathways: |
|
| KEGG Reactions: |
Not Available |
| SMPDB Reactions: |
Not Available |
| PseudoCyc/BioCyc Reactions: |
|
| Complex Reactions: |
|
| Transports: |
Not Available |
| Metabolites: |
|
| GO Classification: |
| Component |
|---|
| DNA helicase complex | | Holliday junction helicase complex | | macromolecular complex | | protein complex | | Function |
|---|
| adenyl nucleotide binding | | adenyl ribonucleotide binding | | ATP binding | | binding | | catalytic activity | | DNA binding | | DNA helicase activity | | four-way junction helicase activity | | helicase activity | | hydrolase activity | | hydrolase activity, acting on acid anhydrides | | hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides | | nucleic acid binding | | nucleoside binding | | nucleoside-triphosphatase activity | | purine nucleoside binding | | pyrophosphatase activity | | Process |
|---|
| cellular macromolecule metabolic process | | DNA metabolic process | | DNA recombination | | DNA repair | | macromolecule metabolic process | | metabolic process |
|
| Gene Properties |
| Locus tag: |
PA0966 |
| Strand: |
+ |
| Entrez Gene ID: |
879609 |
| Accession: |
NP_249657.1 |
| GI: |
15596163 |
| Sequence start: |
1051673 |
| Sequence End: |
1052278 |
| Sequence Length: |
605 |
| Gene Sequence: |
>PA0966
GTGATCGGACGCTTGCGTGGCACCCTGGCGGAGAAACAGCCGCCACACCTGATCCTCGATGTGAATGGCGTCGGCTATGAAGTGGAAGTGCCGATGACGACCCTCTATCGGTTGCCTTCGGTGGGCGAGCCGGTGACCTTGCATACCCATCTGGTTGTGCGTGAGGATGCGCACTTGCTCTATGGCTTCGCCGAAAAGCGCGAGCGAGAGCTGTTCCGTGAGCTGATCCGGCTCAACGGCGTGGGTCCGAAACTGGCCCTGGCGCTGATGTCGGGCCTGGAAGTGGACGAACTGGTGCGTTGCGTCCAGGCACAGGACACCTCCACCCTGGTGAAGATCCCCGGTGTTGGCAAGAAGACCGCCGAGCGCCTGCTGGTGGAGTTGAAGGACCGCTTCAAGGCTTGGGAAAACATGCCCACGATTGCACCGTTGGTGATGGAACCCCGTGCCAGCGCTACAGTCTCAAGCGCCGAGGCCGATGCAGTCAGCGCGCTGATCGCCCTCGGCTTCAAGCCACAGGAAGCCAGTCGTGCCGTCGCAGCCGTACCGGGAGAGGATTTGTCCAGCGAAGAAATGATCCGCCAGGCCCTGAAGGGCATGGTCTAG |
| Protein Properties |
| Protein Residues: |
201 |
| Protein Molecular Weight: |
21.9 kDa |
| Protein Theoretical pI: |
6.14 |
| Hydropathicity (GRAVY score): |
0.037 |
| Charge at pH 7 (predicted): |
-2.07 |
| Protein Sequence: |
>PA0966
MIGRLRGTLAEKQPPHLILDVNGVGYEVEVPMTTLYRLPSVGEPVTLHTHLVVREDAHLLYGFAEKRERELFRELIRLNGVGPKLALALMSGLEVDELVRCVQAQDTSTLVKIPGVGKKTAERLLVELKDRFKAWENMPTIAPLVMEPRASATVSSAEADAVSALIALGFKPQEASRAVAAVPGEDLSSEEMIRQALKGMV |
| References |
| External Links: |
|
| General Reference: |
PaperBLAST - Find papers about PA0966 and its homologs
|
