Identification |
Name: |
Tryptophan biosynthesis protein trpCF |
Synonyms: |
- Indole-3-glycerol phosphate synthase
- IGPS
- N-(5'-phospho-ribosyl)anthranilate isomerase
- PRAI
|
Gene Name: |
trpC |
Enzyme Class: |
|
Biological Properties |
General Function: |
Involved in catalytic activity |
Specific Function: |
Bifunctional enzyme that catalyzes two sequential steps of tryptophan biosynthetic pathway. The first reaction is catalyzed by the isomerase, coded by the trpF domain; the second reaction is catalyzed by the synthase, coded by the trpC domain |
Cellular Location: |
Not Available |
KEGG Pathways: |
|
KEGG Reactions: |
| | |
| → | |
| | | |
|
SMPDB Reactions: |
|
N-(5-phosphoribosyl)-anthranilate | + | | → | 1-(o-carboxyphenylamino)-1'-deoxyribulose 5'-phosphate | + | |
| | |
1-(o-carboxyphenylamino)-1'-deoxyribulose 5'-phosphate | + | | + | | → | | + | |
| | |
1-(o-carboxyphenylamino)-1'-deoxyribulose 5'-phosphate | + | | + | | → | | + | | + | (1S,2R)-1-C-(indol-3-yl)glycerol 3-phosphate | + | |
| | |
N-(5-phosphoribosyl)-anthranilate | + | | → | |
| | |
| + | | → | | + | | + | (1S,2R)-1-C-(indol-3-yl)glycerol 3-phosphate | + | |
| |
|
PseudoCyc/BioCyc Reactions: |
| | | | |
| → | |
| |
|
Complex Reactions: |
Not Available |
Transports: |
Not Available |
Metabolites: |
PAMDB ID | Name | View |
---|
PAMDB006317 | N-(5-phosphoribosyl)-anthranilate | MetaboCard | PAMDB006319 | (1S,2R)-1-C-(indol-3-yl)glycerol 3-phosphate | MetaboCard | PAMDB000868 | 1-(2-Carboxyphenylamino)-1'-deoxy-D-ribulose 5'-phosphate | MetaboCard | PAMDB001862 | 1-(2-Carboxyphenylamino)-1'-deoxyribulose-5'-phosphate | MetaboCard | PAMDB006318 | 1-(o-carboxyphenylamino)-1'-deoxyribulose 5'-phosphate | MetaboCard | PAMDB000568 | Carbon dioxide | MetaboCard | PAMDB001633 | Hydrogen ion | MetaboCard | PAMDB001007 | Indoleglycerol phosphate | MetaboCard | PAMDB001021 | N-(5-Phospho-D-ribosyl)anthranilate | MetaboCard | PAMDB000142 | Water | MetaboCard |
|
GO Classification: |
Function |
---|
carbon-carbon lyase activity | carboxy-lyase activity | catalytic activity | indole-3-glycerol-phosphate synthase activity | intramolecular oxidoreductase activity | intramolecular oxidoreductase activity, interconverting aldoses and ketoses | isomerase activity | lyase activity | phosphoribosylanthranilate isomerase activity | Process |
---|
cellular amino acid and derivative metabolic process | cellular amino acid derivative metabolic process | cellular biogenic amine metabolic process | cellular metabolic process | indolalkylamine metabolic process | metabolic process | tryptophan metabolic process |
|
Gene Properties |
Locus tag: |
PA0651 |
Strand: |
+ |
Entrez Gene ID: |
882120 |
Accession: |
NP_249342.1 |
GI: |
15595848 |
Sequence start: |
705130 |
Sequence End: |
705966 |
Sequence Length: |
836 |
Gene Sequence: |
>PA0651
GTGAGTGTGCCGACGGTTCTGCAGAAGATCCTCGCCCGCAAGGCCGAGGAGGTCGCCGAGCGCCGTGCGCGCGTCAACCTGGCAGAGGTCGAGCGGCTGGCGCGTAGCGCCGATGCGCCGCGCGGCTTCGCCAATGCCCTGCTGGAGCGGGCCAAGCGCAAGGAGCCGGCAGTGATCGCCGAGATCAAGAAGGCATCGCCGAGCAAGGGCGTGCTGCGCGAACACTTCGTCCCGGCGGAGATCGCCCGCAGCTACGAGGCGGGTGGCGCGGCGTGCCTGTCGGTGCTCACCGACGTGGACTTCTTCCAGGGCGCCGATGCCTATCTGAAGGAAGCGCGGGCCGCCTGTGCGCTGCCGGTGATCCGCAAGGACTTCATGATCGATCCGTACCAGATCGTCGAGGCGCGGGCGATCGGTGCCGACTGCATCCTGCTGATCGTCTCGGCGCTGGACGACGTGCTGATGGCCGAACTGGCGGCGACTGCCAAGTCGGTCGGTCTCGACGTACTGGTCGAAGTGCATGACGGCACCGAGCTGGAACGTGCACTGAAGACCCTGGACACGCCGTTGGTGGGCATCAACAACCGCAACCTGCACACCTTCGAGGTGAGCCTGGAAACCACCCTCGACCTGTTGCCGGAAATTCCCCGCGACCGCCTGGTGGTCACCGAGAGCGGTATTCTCAACCGGGCCGACGTGGAGCTGATGGAAGTCAGCGAGGTCTACGCCTTCCTGGTTGGCGAGGCGTTCATGCGGGCCGACGATCCTGGCCTCGAGCTGAAGCGCCTGTTCTTCCAGGAGCGTGGTGCTGTGGTGCTGGGCGCCGATCCTGACTGA |
Protein Properties |
Protein Residues: |
278 |
Protein Molecular Weight: |
30.3 kDa |
Protein Theoretical pI: |
4.64 |
Hydropathicity (GRAVY score): |
0.112 |
Charge at pH 7 (predicted): |
-11.35 |
Protein Sequence: |
>PA0651
MSVPTVLQKILARKAEEVAERRARVNLAEVERLARSADAPRGFANALLERAKRKEPAVIAEIKKASPSKGVLREHFVPAEIARSYEAGGAACLSVLTDVDFFQGADAYLKEARAACALPVIRKDFMIDPYQIVEARAIGADCILLIVSALDDVLMAELAATAKSVGLDVLVEVHDGTELERALKTLDTPLVGINNRNLHTFEVSLETTLDLLPEIPRDRLVVTESGILNRADVELMEVSEVYAFLVGEAFMRADDPGLELKRLFFQERGAVVLGADPD |
References |
External Links: |
|
General Reference: |
PaperBLAST - Find papers about PA0651 and its homologs
|