| Identification |
| Name: |
2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase |
| Synonyms: |
|
| Gene Name: |
ispF |
| Enzyme Class: |
|
| Biological Properties |
| General Function: |
Involved in 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity |
| Specific Function: |
Converts 4-diphosphocytidyl-2-C-methyl-D-erythritol 2- phosphate into 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (MECDP) and CMP. Also converts 4-diphosphocytidyl-2-C-methyl-D- erythritol into 2-C-methyl-D-erythritol 3,4-cyclophosphate and CMP |
| Cellular Location: |
Not Available |
| KEGG Pathways: |
|
| KEGG Reactions: |
|
| SMPDB Reactions: |
|
2-phospho-4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol | + |  | → | Cytidine monophosphate | + |  | + |  |
| | |
 | + | 2-Phospho-4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol | → |  | + | Cytidine monophosphate | + |  |
| |
|
| PseudoCyc/BioCyc Reactions: |
|
| Complex Reactions: |
|
| Transports: |
Not Available |
| Metabolites: |
| PAMDB ID | Name | View |
|---|
| PAMDB003502 | 2-C-Methyl-D-erythritol 2,4-cyclodiphosphate | MetaboCard | | PAMDB000611 | 2-C-Methyl-D-erythritol-2,4-cyclodiphosphate | MetaboCard | | PAMDB000898 | 2-Phospho-4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol | MetaboCard | | PAMDB000035 | Cytidine monophosphate | MetaboCard |
|
| GO Classification: |
| Function |
|---|
| 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity | | catalytic activity | | lyase activity | | phosphorus-oxygen lyase activity | | Process |
|---|
| cellular lipid metabolic process | | isoprenoid metabolic process | | lipid metabolic process | | metabolic process | | primary metabolic process | | terpenoid biosynthetic process | | terpenoid metabolic process |
|
| Gene Properties |
| Locus tag: |
PA3627 |
| Strand: |
- |
| Entrez Gene ID: |
880484 |
| Accession: |
NP_252317.1 |
| GI: |
15598823 |
| Sequence start: |
4062426 |
| Sequence End: |
4062899 |
| Sequence Length: |
473 |
| Gene Sequence: |
>PA3627
ATGCGAATTGGCCATGGCTACGACGTGCATCGCTTCGGCGAGGGCGACTTCATCACCCTCGGCGGCGTGCGCATTCCCCACAAACATGGGCTGGTCGCCCACTCCGACGGCGACGTGCTGCTGCACGCCTTGTCCGATGCGCTGCTCGGCGCGGCGGCGCTGGGCGACATCGGCAAGCACTTCCCGGACACCGACCCGCGGTTCAAGGGCGCCGACAGTCGCGCGCTGCTGCGACACGTGGTCGCCATCGTCGCCGAGAAGGGCTGGAAGGTCGGCAACGTCGACGCCACGATCGTCGCCCAGGCGCCGAAGATGGCGCCGCACATCGAGACCATGCGCGGGTTGATCGCCGAGGACCTCGGCGTCGCGGTCGACCAGGTCAACGTCAAGGCCACCACTACCGAGCGGCTAGGTTTCACCGGACGCGAAGAGGGCATTGCTGTACATGCGGTCGCTTTGCTGATGGCCCGATGA |
| Protein Properties |
| Protein Residues: |
157 |
| Protein Molecular Weight: |
16.7 kDa |
| Protein Theoretical pI: |
7.1 |
| Hydropathicity (GRAVY score): |
0.086 |
| Charge at pH 7 (predicted): |
0.39 |
| Protein Sequence: |
>PA3627
MRIGHGYDVHRFGEGDFITLGGVRIPHKHGLVAHSDGDVLLHALSDALLGAAALGDIGKHFPDTDPRFKGADSRALLRHVVAIVAEKGWKVGNVDATIVAQAPKMAPHIETMRGLIAEDLGVAVDQVNVKATTTERLGFTGREEGIAVHAVALLMAR |
| References |
| External Links: |
|
| General Reference: |
PaperBLAST - Find papers about PA3627 and its homologs
|