nitrogen-regulated sRNA, NrsZ (PA5125.1)
| Identification | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Name: | nitrogen-regulated sRNA, NrsZ | |||||||||
| Synonyms: | Not Available | |||||||||
| Gene Name: | nrsZ | |||||||||
| Enzyme Class: | Not Available | |||||||||
| Biological Properties | ||||||||||
| General Function: | pathogenesis, bacterial-type flagellum-dependent swarming motility, cellular response to nitrogen starvation, regulation of bacterial-type flagellum-dependent cell motility, pathogenesis, bacterial-type flagellum-dependent swarming motility, cellular response to nitrogen starvation, regulation of bacterial-type flagellum-dependent cell motility | |||||||||
| Specific Function: | Not Available | |||||||||
| Cellular Location: | Not Available | |||||||||
| KEGG Pathways: |
| |||||||||
| KEGG Reactions: | Not Available | |||||||||
| SMPDB Reactions: | Not Available | |||||||||
| PseudoCyc/BioCyc Reactions: |
| |||||||||
| Complex Reactions: | Not Available | |||||||||
| Transports: | Not Available | |||||||||
| Metabolites: | Not Available | |||||||||
| GO Classification: |
| |||||||||
| Gene Properties | ||||||||||
| Locus tag: | PA5125.1 | |||||||||
| Strand: | + | |||||||||
| Entrez Gene ID: | Not Available | |||||||||
| Accession: | Not Available | |||||||||
| GI: | Not Available | |||||||||
| Sequence start: | 5775397 | |||||||||
| Sequence End: | 5775623 | |||||||||
| Sequence Length: | 226 | |||||||||
| Gene Sequence: |
>PA5125.1 AACGAAGATTTCGGGGGCCTCGGTACAGGCAGGCTGGGGAATCCCCTCTTTTACACCCGGCGGCAGACGCAGCATCCGCGCGCAACCGCCACACCCGTTTCGGGGACCTCGGTACAGGCAGGCTGAGAACTCCCCTCTTTTATGCCCGGCGGTAGCGCAGCGATCCGCGCCTCCGCCCTCCCGTTTGGGGACCTCGGTACAGGCAGGCTGAGAATTCCCCCTTTTAT | |||||||||
| Protein Properties | ||||||||||
| Protein Residues: | 75 | |||||||||
| Protein Molecular Weight: | Not Available kDa | |||||||||
| Protein Theoretical pI: | Not Available | |||||||||
| Hydropathicity (GRAVY score): | Not Available | |||||||||
| Charge at pH 7 (predicted): | Not Available | |||||||||
| Protein Sequence: |
>PA5125.1
Not Available | |||||||||
| References | ||||||||||
| External Links: |
| |||||||||
| General Reference: | PaperBLAST - Find papers about PA5125.1 and its homologs | |||||||||