translocation protein TatB (PA5069)

Identification
Name: translocation protein TatB
Synonyms: yigT; mttA
Gene Name: tatB
Enzyme Class: Not Available
Biological Properties
General Function: protein transport by the Tat complex, protein secretion, protein transport
Specific Function: protein transmembrane transporter activity, protein transporter activity, protein transmembrane transporter activity
Cellular Location: Cytoplasmic Membrane
KEGG Pathways:
    KEGG Reactions: Not Available
    SMPDB Reactions: Not Available
    PseudoCyc/BioCyc Reactions:
    Complex Reactions: Not Available
    Transports: Not Available
    Metabolites: Not Available
    GO Classification:
    Component
    TAT protein transport complex
    membrane
    TAT protein transport complex
    Function
    protein transmembrane transporter activity
    protein transporter activity
    protein transmembrane transporter activity
    Process
    protein transport by the Tat complex
    protein secretion
    protein transport
    Gene Properties
    Locus tag: PA5069
    Strand: +
    Entrez Gene ID: 879670
    Accession: NP_253756.1
    GI: 15600262
    Sequence start: 5706814
    Sequence End: 5707239
    Sequence Length: 425
    Gene Sequence: 
    >PA5069
ATGTTCGGAATCAGCTTCAGCGAACTGTTGCTGGTCGGGCTGGTCGCCCTGCTGGTGCTCGGCCCCGAGCGCCTGCCGGGCGCCGCACGTACCGCCGGCCTGTGGATCGGCCGCCTGAAGCGCAGTTTCAATACCATCAAGCAGGAAGTGGAACGGGAAATCGGCGCGGACGAGATTCGCCGGCAACTGCACAACGAGCACATCCTCTCGATGGAGCGCGAAGCGCAGAAGCTGCTGGCCCCGCTGACCGGCCAGAATCCCCCGCAGGAAACCCCGCCGCCGGCGGCCGAGAGCCCGGCGCCGAGCGTACCCACGCCGCCGCCGACCAGCACGCCTGCGGTTCCGCCCGCGGACGCCGCGGCACCGCCGGCAGTCGCTGCCTCCACTCCCCCTTCGCCACCGTCCGAGACGCCGCGTAATCCATGA
    Protein Properties
    Protein Residues: 141
    Protein Molecular Weight: 14.9 kDa
    Protein Theoretical pI: 5.75
    Hydropathicity (GRAVY score): -0.28
    Charge at pH 7 (predicted): -1.53
    Protein Sequence: 
    >PA5069
MFGISFSELLLVGLVALLVLGPERLPGAARTAGLWIGRLKRSFNTIKQEVEREIGADEIRRQLHNEHILSMEREAQKLLAPLTGQNPPQETPPPAAESPAPSVPTPPPTSTPAVPPADAAAPPAVAASTPPSPPSETPRNP
    References
    External Links:
    Resource Link
    Genome ID: PA5069
    Entrez Gene ID: 879670
    NCBI Protein ID: 15600262
    General Reference: PaperBLAST - Find papers about PA5069 and its homologs