probable sigma-70 factor, ECF subfamily (PA4896)

Identification
Name: probable sigma-70 factor, ECF subfamily
Synonyms: Not Available
Gene Name: Not Available
Enzyme Class: Not Available
Biological Properties
General Function: DNA-templated transcription, initiation, regulation of transcription, DNA-templated, regulation of iron ion transport
Specific Function: DNA binding, sequence-specific DNA binding transcription factor activity, sigma factor activity
Cellular Location: Cytoplasmic
KEGG Pathways:
    KEGG Reactions: Not Available
    SMPDB Reactions: Not Available
    PseudoCyc/BioCyc Reactions:
    Complex Reactions: Not Available
    Transports: Not Available
    Metabolites: Not Available
    GO Classification:
    Component
    cytosol
    Function
    DNA binding
    sequence-specific DNA binding transcription factor activity
    sigma factor activity
    Process
    DNA-templated transcription, initiation
    regulation of transcription, DNA-templated
    regulation of iron ion transport
    Gene Properties
    Locus tag: PA4896
    Strand: -
    Entrez Gene ID: 878636
    Accession: NP_253583.1
    GI: 15600089
    Sequence start: 5490645
    Sequence End: 5491181
    Sequence Length: 536
    Gene Sequence: 
    >PA4896
ATGAATGCGCCGAGTTCCTGCCTGTCCGCGGACCGCGACGGCGTCGCCACGCTCTACCGTGAAAACCATGCCTGGCTGCGCAACTGGCTGGCCTACCGACTCCGCTCCTGGGGACGCGGCGTGGCCGACGACCTGGCCCATGACACCTTCCTGCGCATTCTCGCCAGCCGCGACGGCGGCCAGCGTGAAGCGATCCGTCAGCCGCGCGCCTATCTCACCCGTATCGCCAACTGCGTGCTGGTCAGTTGGCGCCGTCGCCAATCGCTGGAACTTGCCTGGCTGGAGGCCCTGGCCACGCTGCCCGAGCCGTTGCAGCCGTCGCCGGAACAACAGAGCGTGATCGTCGAGACCCTGCACGAGATCGACGCGCTGCTCGACACCCTGCGCCCGCGGGTGAAACAGGCATTCCTGATGGCGACGCTGGACGGCATGAAGCAGAAGGACATCGCCCAGGCGCTGGGCGTCGCGCTGCCGACGGTGAAGAAGTTCATCCACCAGGCCTACGTGACCTGCCTGAGCCTGATGCCCGATGAATGA
    Protein Properties
    Protein Residues: 178
    Protein Molecular Weight: 20.2 kDa
    Protein Theoretical pI: 8.49
    Hydropathicity (GRAVY score): -0.199
    Charge at pH 7 (predicted): 2.86
    Protein Sequence: 
    >PA4896
MNAPSSCLSADRDGVATLYRENHAWLRNWLAYRLRSWGRGVADDLAHDTFLRILASRDGGQREAIRQPRAYLTRIANCVLVSWRRRQSLELAWLEALATLPEPLQPSPEQQSVIVETLHEIDALLDTLRPRVKQAFLMATLDGMKQKDIAQALGVALPTVKKFIHQAYVTCLSLMPDE
    References
    External Links:
    Resource Link
    Genome ID: PA4896
    Entrez Gene ID: 878636
    NCBI Protein ID: 15600089
    General Reference: PaperBLAST - Find papers about PA4896 and its homologs