
regulatory RNA PrrF2 (PA4704.2)
Identification | |||||||||
---|---|---|---|---|---|---|---|---|---|
Name: | regulatory RNA PrrF2 | ||||||||
Synonyms: | PrrF2 | ||||||||
Gene Name: | prrF2 | ||||||||
Enzyme Class: | Not Available | ||||||||
Biological Properties | |||||||||
General Function: | regulation of translation, regulation of metabolic process, negative regulation of translation, ncRNA-mediated, cellular response to iron ion starvation, regulation of cellular response to iron ion starvation, anthranilate catabolic process, regulation of carbon utilization | ||||||||
Specific Function: | Not Available | ||||||||
Cellular Location: | Not Available | ||||||||
KEGG Pathways: |
| ||||||||
KEGG Reactions: | Not Available | ||||||||
SMPDB Reactions: | Not Available | ||||||||
PseudoCyc/BioCyc Reactions: |
| ||||||||
Complex Reactions: | Not Available | ||||||||
Transports: | Not Available | ||||||||
Metabolites: | Not Available | ||||||||
GO Classification: |
| ||||||||
Gene Properties | |||||||||
Locus tag: | PA4704.2 | ||||||||
Strand: | + | ||||||||
Entrez Gene ID: | 4179185 | ||||||||
Accession: | Not Available | ||||||||
GI: | Not Available | ||||||||
Sequence start: | 5284206 | ||||||||
Sequence End: | 5284319 | ||||||||
Sequence Length: | 113 | ||||||||
Gene Sequence: |
>PA4704.2 AACTGGTCGCGAGGCCAGCAGGTAAGCTGAGAGACCAAGCAGTCGGACTCTTCAGATTATCTCCTCATCAGGCTAATCACGGTTTCGACCCGGCACTTTGCCGGGTCTTTTTTT | ||||||||
Protein Properties | |||||||||
Protein Residues: | 37 | ||||||||
Protein Molecular Weight: | Not Available kDa | ||||||||
Protein Theoretical pI: | Not Available | ||||||||
Hydropathicity (GRAVY score): | Not Available | ||||||||
Charge at pH 7 (predicted): | Not Available | ||||||||
Protein Sequence: |
>PA4704.2
Not Available | ||||||||
References | |||||||||
External Links: |
| ||||||||
General Reference: | PaperBLAST - Find papers about PA4704.2 and its homologs |