Transcriptional regulator of N-Acetylglucosamine catabolism operon (PA3757)
| Identification | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Name: | Transcriptional regulator of N-Acetylglucosamine catabolism operon | ||||||||
| Synonyms: | Not Available | ||||||||
| Gene Name: | nagR | ||||||||
| Enzyme Class: | Not Available | ||||||||
| Biological Properties | |||||||||
| General Function: | regulation of transcription, DNA-templated, positive regulation of metabolic process | ||||||||
| Specific Function: | DNA binding, sequence-specific DNA binding transcription factor activity, transcription regulatory region DNA binding | ||||||||
| Cellular Location: | Cytoplasmic | ||||||||
| KEGG Pathways: |
| ||||||||
| KEGG Reactions: | Not Available | ||||||||
| SMPDB Reactions: | Not Available | ||||||||
| PseudoCyc/BioCyc Reactions: |
| ||||||||
| Complex Reactions: | Not Available | ||||||||
| Transports: | Not Available | ||||||||
| Metabolites: | Not Available | ||||||||
| GO Classification: |
| ||||||||
| Gene Properties | |||||||||
| Locus tag: | PA3757 | ||||||||
| Strand: | + | ||||||||
| Entrez Gene ID: | 880315 | ||||||||
| Accession: | NP_252446.1 | ||||||||
| GI: | 15598952 | ||||||||
| Sequence start: | 4207408 | ||||||||
| Sequence End: | 4208151 | ||||||||
| Sequence Length: | 743 | ||||||||
| Gene Sequence: |
>PA3757 ATGAAGACAGCCCACGACCTGCTCCTGGCCCTGCGTCCCGACGAGGCGCAACCCACCCCCCTCTATCTGCAACTGGCGCGCAATCTCGAGAGCGCGATCCATGCCGGCCAGTGGAAAGCGGAGGAAGCGCTGCCCTCCGAACGCAACCTCAGCGAAACCCTGAACATTTCCCGCGTCACCGCGCGCAAGGCCCTCGAAGTACTCTTCGAGCAGGGCCTGATCCGCCGCAACCAGGGCTCCGGCACCTTCATTACGCCGCGTCTCGAACAACCGTTGTCGCGTCTCTCCAGCTTCAGCGAGATGCTCCGCCTGAAAGGCTTCACCCCCGGCTCCACCTGGCTGGAGCGCGGCATCGCCCTGCCCACCCACGACGAACTGATCCGCCTCGGCCTCTCGCCGACCGAGAAGGTCACGCGCATGAAGCGCCTGCGCAAGGCCGACGGCACAGTGATGGCGATCGAGAACAGCACCCTGCCGGCGCGCCTGCTGCCGGACCCGACAGCGGTCGGCGATTCCCTCTACGAATACCTGGACGGCATCGGTCGCCCAGTGGTCCGCGCCCTCCAGCACGTGCGCGCGATCAACTCGTCCGCGTCCGATGCCGCGCTGGTCGGCATCGCGCCGGGCACCGCGATGCTGCTGATGACCCGGATCGGCTACCTCGAGGACAACACCCCGATCGAGCTGACCGACACCTACTGCCGCAACGACTACTACGACTTCGTCGCCGAACTGCGACGCTGA | ||||||||
| Protein Properties | |||||||||
| Protein Residues: | 247 | ||||||||
| Protein Molecular Weight: | 27.5 kDa | ||||||||
| Protein Theoretical pI: | 7.67 | ||||||||
| Hydropathicity (GRAVY score): | -0.252 | ||||||||
| Charge at pH 7 (predicted): | 0.93 | ||||||||
| Protein Sequence: |
>PA3757 MKTAHDLLLALRPDEAQPTPLYLQLARNLESAIHAGQWKAEEALPSERNLSETLNISRVTARKALEVLFEQGLIRRNQGSGTFITPRLEQPLSRLSSFSEMLRLKGFTPGSTWLERGIALPTHDELIRLGLSPTEKVTRMKRLRKADGTVMAIENSTLPARLLPDPTAVGDSLYEYLDGIGRPVVRALQHVRAINSSASDAALVGIAPGTAMLLMTRIGYLEDNTPIELTDTYCRNDYYDFVAELRR | ||||||||
| References | |||||||||
| External Links: |
| ||||||||
| General Reference: | PaperBLAST - Find papers about PA3757 and its homologs | ||||||||