| Identification |
| Name: |
alginate and motility regulator Z AlgZ |
| Synonyms: |
algZ |
| Gene Name: |
amrZ |
| Enzyme Class: |
Not Available |
| Biological Properties |
| General Function: |
positive regulation of cell motility, positive regulation of single-species biofilm formation on inanimate substrate, bacterial-type flagellum assembly, regulation of transcription, DNA-templated, regulation of polysaccharide biosynthetic process, regulation of polysaccharide biosynthetic process, negative regulation of cyclic nucleotide biosynthetic process, pathogenesis, negative regulation of single-species biofilm formation on inanimate substrate, type IV pilus-dependent motility, negative regulation of bacterial-type flagellum-dependent cell motility |
| Specific Function: |
DNA binding, transcription regulatory region DNA binding, bacterial-type RNA polymerase enhancer sequence-specific DNA binding, bacterial-type RNA polymerase core promoter proximal region sequence-specific DNA binding |
| Cellular Location: |
Cytoplasmic |
| KEGG Pathways: |
|
| KEGG Reactions: |
Not Available |
| SMPDB Reactions: |
Not Available |
| PseudoCyc/BioCyc Reactions: |
|
| Complex Reactions: |
Not Available |
| Transports: |
Not Available |
| Metabolites: |
Not Available |
| GO Classification: |
| Function |
|---|
| DNA binding | | transcription regulatory region DNA binding | | bacterial-type RNA polymerase enhancer sequence-specific DNA binding | | bacterial-type RNA polymerase core promoter proximal region sequence-specific DNA binding | | Process |
|---|
| positive regulation of cell motility | | positive regulation of single-species biofilm formation on inanimate substrate | | bacterial-type flagellum assembly | | regulation of transcription, DNA-templated | | regulation of polysaccharide biosynthetic process | | regulation of polysaccharide biosynthetic process | | negative regulation of cyclic nucleotide biosynthetic process | | pathogenesis | | negative regulation of single-species biofilm formation on inanimate substrate | | type IV pilus-dependent motility | | negative regulation of bacterial-type flagellum-dependent cell motility |
|
| Gene Properties |
| Locus tag: |
PA3385 |
| Strand: |
+ |
| Entrez Gene ID: |
878714 |
| Accession: |
NP_252075.1 |
| GI: |
15598581 |
| Sequence start: |
3791347 |
| Sequence End: |
3791673 |
| Sequence Length: |
326 |
| Gene Sequence: |
>PA3385
ATGCGCCCACTGAAACAGGCAACTCCTACCTACTCCAGCCGTACCGCTGACAAATTCGTCGTTCGTCTGCCCGAGGGCATGCGTGAGCAGATCGCAGAAGTCGCTCGCAGCCATCACCGCAGCATGAACTCCGAGATCATCGCCCGACTCGAGCAGAGCCTGCTCCAGGAAGGGGCGCTGCAAGACAATCTCGGTGTTCGCCTGGACAGCCCGGAACTCAGCCTGCACGAGCGCGAGCTGCTGCAGCGTTTCCGCCAGCTGACCCACCGTCAGCAGAACGCGCTGGTCGCCCTGATCGCACACGATGCGGAGCTGGCCCAGGCCTGA |
| Protein Properties |
| Protein Residues: |
108 |
| Protein Molecular Weight: |
12.3 kDa |
| Protein Theoretical pI: |
7.93 |
| Hydropathicity (GRAVY score): |
-0.534 |
| Charge at pH 7 (predicted): |
1.19 |
| Protein Sequence: |
>PA3385
MRPLKQATPTYSSRTADKFVVRLPEGMREQIAEVARSHHRSMNSEIIARLEQSLLQEGALQDNLGVRLDSPELSLHERELLQRFRQLTHRQQNALVALIAHDAELAQA |
| References |
| External Links: |
|
| General Reference: |
PaperBLAST - Find papers about PA3385 and its homologs
|
