
probable transcriptional regulator (PA3260)
| Identification | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Name: | probable transcriptional regulator | ||||||||
| Synonyms: | Not Available | ||||||||
| Gene Name: | Not Available | ||||||||
| Enzyme Class: | Not Available | ||||||||
| Biological Properties | |||||||||
| General Function: | Not Available | ||||||||
| Specific Function: | DNA binding, sequence-specific DNA binding | ||||||||
| Cellular Location: | Unknown | ||||||||
| KEGG Pathways: |
| ||||||||
| KEGG Reactions: | Not Available | ||||||||
| SMPDB Reactions: | Not Available | ||||||||
| PseudoCyc/BioCyc Reactions: |
| ||||||||
| Complex Reactions: | Not Available | ||||||||
| Transports: | Not Available | ||||||||
| Metabolites: | Not Available | ||||||||
| GO Classification: |
| ||||||||
| Gene Properties | |||||||||
| Locus tag: | PA3260 | ||||||||
| Strand: | - | ||||||||
| Entrez Gene ID: | 882423 | ||||||||
| Accession: | NP_251950.1 | ||||||||
| GI: | 15598456 | ||||||||
| Sequence start: | 3647755 | ||||||||
| Sequence End: | 3648066 | ||||||||
| Sequence Length: | 311 | ||||||||
| Gene Sequence: |
>PA3260 ATGAATGTCCAAGTGATCACGCGAGACGGCGAGGCGGAATACGCGGTGTTGCCCTGGGCCGAATACCAGGCGTTGCTGGCCGCCGCCGGTCGCCCGGCCGCCAGTGTCGCGGTGGAGACGACCGCGCCGGCGCCGCCTTCCGCGAGTCTGCTGGAGCGCCGCGAGGCGCGCGGCCTGAGCCTGGAACAGGTGGCCCGGGAGGTCGGTATCAGTCCTTCCTACATGGCGATGATCGAACGCGGCGAACGCGAGGCCAGCGAGGCCATCCTGTTCGCCCTGGAGCGTGTGCTGGGCAAAGCGACGGGGGCCTGA | ||||||||
| Protein Properties | |||||||||
| Protein Residues: | 103 | ||||||||
| Protein Molecular Weight: | 10.9 kDa | ||||||||
| Protein Theoretical pI: | 4.5 | ||||||||
| Hydropathicity (GRAVY score): | 0.028 | ||||||||
| Charge at pH 7 (predicted): | -4.01 | ||||||||
| Protein Sequence: |
>PA3260 MNVQVITRDGEAEYAVLPWAEYQALLAAAGRPAASVAVETTAPAPPSASLLERREARGLSLEQVAREVGISPSYMAMIERGEREASEAILFALERVLGKATGA | ||||||||
| References | |||||||||
| External Links: |
| ||||||||
| General Reference: | PaperBLAST - Find papers about PA3260 and its homologs | ||||||||