
ECF sigma factor FoxI ECF sigma factor FoxI (PA2468)
Identification | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Name: | ECF sigma factor FoxI ECF sigma factor FoxI | |||||||||||
Synonyms: | foxI | |||||||||||
Gene Name: | foxI | |||||||||||
Enzyme Class: | Not Available | |||||||||||
Biological Properties | ||||||||||||
General Function: | DNA-templated transcription, initiation, regulation of transcription, DNA-templated, regulation of iron ion transport | |||||||||||
Specific Function: | sequence-specific DNA binding transcription factor activity, DNA binding, sigma factor activity, sigma factor activity | |||||||||||
Cellular Location: | Cytoplasmic | |||||||||||
KEGG Pathways: |
| |||||||||||
KEGG Reactions: | Not Available | |||||||||||
SMPDB Reactions: | Not Available | |||||||||||
PseudoCyc/BioCyc Reactions: |
| |||||||||||
Complex Reactions: | Not Available | |||||||||||
Transports: | Not Available | |||||||||||
Metabolites: | Not Available | |||||||||||
GO Classification: |
| |||||||||||
Gene Properties | ||||||||||||
Locus tag: | PA2468 | |||||||||||
Strand: | - | |||||||||||
Entrez Gene ID: | 882912 | |||||||||||
Accession: | NP_251158.1 | |||||||||||
GI: | 15597664 | |||||||||||
Sequence start: | 2786365 | |||||||||||
Sequence End: | 2786883 | |||||||||||
Sequence Length: | 518 | |||||||||||
Gene Sequence: |
>PA2468 ATGTCCGCCCCGATCCTTCTCAGCGCCCACCATCGCGCCATGCATGCGCTGTACAGCGAGCACCATGGCTGGTTGCAGAACTGGCTGCGCGGCAAGCTGGGCTGCGCGGCGGACGCGGCGGACCTGGCCCAGGACACCTTCCTGCGCATCCTGCTCAAGCGCGAACTGCGCGAGATCGGCATGCCGCGCGCGTTCCTGCGGACCATCGCCCGCGGCCTGGTGATCGACCACTGGCGTCGCGAGGAACTGCAGCGCGCCTACCTCGAAAGCATCGCCCACCTGCCCGAGGCACAGGCGCCGTCGCCCGAGGCGCGGGAACTGGTGCTGGAACTGCTGGAGGAAATCTCGCGGATGCTCGACGGGCTCAAGCCGAAGGTCCGCACCGCCTTCCTCCTGGCCCAGTGCGAAGACCTCAGCCACCGGCAGATCGCCGAACGCATGGGGGTTTCCCAGCGTAGCGTCGAGCGCTACGTGGCCGAGGCGCTGTACCACTGCTACCTGCTGCGCTACGGCGAATGA | |||||||||||
Protein Properties | ||||||||||||
Protein Residues: | 172 | |||||||||||
Protein Molecular Weight: | 19.9 kDa | |||||||||||
Protein Theoretical pI: | 7.7 | |||||||||||
Hydropathicity (GRAVY score): | -0.234 | |||||||||||
Charge at pH 7 (predicted): | 2.07 | |||||||||||
Protein Sequence: |
>PA2468 MSAPILLSAHHRAMHALYSEHHGWLQNWLRGKLGCAADAADLAQDTFLRILLKRELREIGMPRAFLRTIARGLVIDHWRREELQRAYLESIAHLPEAQAPSPEARELVLELLEEISRMLDGLKPKVRTAFLLAQCEDLSHRQIAERMGVSQRSVERYVAEALYHCYLLRYGE | |||||||||||
References | ||||||||||||
External Links: |
| |||||||||||
General Reference: | PaperBLAST - Find papers about PA2468 and its homologs |